>synthetic0|;
agtgggctaccataggtgaaaaacaggtgatttgagccatccataatattgcatgctagattgcggcgggcagtaaggcgtacagggaaaggacacttgtgcagaaggacccgaaatgtacgtcgcgcgaccctaccccacctattttgggacgcaacagaaagttaaaagctaacgtggcgtcctcgatcatccccaacacatacgtgtaacaattggccaccccaatatcaacagtcctagtcggacccggagcttccggcacaagtggattgctgcctacgcgtcggcacacctttcagaaatgggtattggataagcgtccctagacttatgaagagccctacgattcgtagagtagaaaccgggcctccacctggcctcgaaaatcctccagctactgagggctactgattaccagcttttcgcgggattactgagttcgctggccatggggaagttctaggtcgaccaatcctaagtttgggtcgttggtgacttgcatcatatcgtgttagcgcagtcctgcttctgcagctccgacctaggtcccaactaaaaggcattgtgtcgggagaaacagcagtgcaaacgacgatagtcgcaaggctaaagacgttctccgtccatgctacagatatacccacaacatacgtccttgttcaatctttatcacccctggtaagtgatcaagtcgcgcgctgtacgcttacgtcttccggtacgcgttaacttatgaccgcgctgtcaacaatctcatgtcgaggggtcagcataggactaaccaatcgaggatacatggtttcgctcggttagctagcgggcgaagccaattgcacggacagtgcggccctaccaacaaatgtcgtatgggccggggaaccgtcccggatagtggctatcgtatgacgggatccgggcattatatagcgaatgagtcacgctagtggatagttgaaaagccgacttaatctggtgattcggagagttaccgcacgaa
>synthetic1|;
gcggagtcaaatcgagatcatcatgtactccaagggataacaccaatcggccctgcaacatcaggctgttgccttgactacttcggcggcgctgtcgtgtcgtaccaccgcgccaccctcatacacagccgcgacattaacagcgaatctatgacagaatgatcctgttctgaggcgaggcatgaagaagcggcaaaaccctaaccgttttactacaggtcttataatagtggttgcgacggtatcctcccgtgcagactcaaaaaatataccggacctattgtcctaaacatgcaattgctttcttataatacagagctccgcccgagaaggacattggaagacctagccctactacggatttcgccgacgggtgtcttgccattttactccccgtgcgtgaatcaacaggaacctatggcccgcgggacacccctgcattggctatagcgagtctatgttcgaacagggccgttattgtcttgtactgccgtgttcttcgaaccgccttagagataacggaagagcgactcgagttagtttccgatgcggatgtcgtggaaatccctgtaacggtgggacgttatgtcgaaccctcgacagacttatataccccggcgacgcgatacagccgattaatactggagacggcttatcttctttgttggcacgcgcacgagcatttgtgagaggtgagatccaccagttccggcacataaaggttggcagtgtgatacgtcgtcattgacaaggctactattgtgccttgttacccccgccaggccggctgggatggtgcggtatccatattagttagaagcgtacgaatgtggacagacatgggctcggccacctcctaccttgggttttgtgacctcaagctagagtcgtcgttcctaatattctgcagcgagggccagcactaaactgaacctaagtcagggtttcggcacttgggggacccacacatattatcactgctgacgggcctacatcgttc
>synthetic2|;
aggaacgcgcctctggtagagccgaaaacatctagttacagacaattccaaaaagcgccgcaagggcggcccacaggccagtgggggccaccggatacattaacggcaccccccccgtttctaacgctcaagcaactgcgcgaagccaccaagtgggaggactccctgctttatgctacggcagtatgagtgtagtattggtagcagggcgctctctcctagcgacttcctgcgggcgaaaacgtcaacaatcgagacacctacgttcaatagagcgttgtccaggacacctaatctttagaggctaaaacctttatcgacttccctctaacgacgacatacgtggcagataaggggtgtagaacactgcgtctgagccactaatcgacgctgcgttgaccccttattttgcaccgttttgtccatcctttggaaaagaatcttctatttgacttagcctctggttctgggttctgaggcttaacttcgcatctgctatgagcagggcgtccctaaagctggcccctggtaccatacatggtcgcccaggcctacagaggcacagagaagacgaggatatataccggttggggctgaaaattttcgtagcatgcctgtagtaggaggagtggcgttctatcaaacagtggttggctcgcacacatgtgctggtacaagatctaaaagtcccagccctgtagcacctctgcgtatcggcaaaatagccctccggtgatgcactgagtacggtaaacccgccagtggaggggtccatatcagctgcaccaaaataaggtataaactttgttgttatagctagatccattgcagcagattctccatatggcgttcaaaatttccaatctagcgaagctctcggaaactagaaacgctgatcgtagcgcgtttcgcctccaccttgaattaaagctacacgtagttcatggctgtcagtacgcgcagagtattttgcatgcctccgttcaacaacggggttaca
>synthetic3|;
aacgtcaccactccgtgcctctaggcgccttggaagtagcaggtgtaatcttcatagaggtgagttatgtaggcccctgcagggcaaaaccgtgcgcgagccatttcagacccgcacaagaacacactaacggtcgaagctgctgagcgggctcgacaatgccagagcatggcatctggcaggatgtcgggtgaccacggcacgtccactacgaccttacgaatggcggacttatgggtccacgcataaaccctcttagcaacaaatgtatgcataataatcccgggatcgtgggtggcgctttaggtcgtgtaaagctaatagtaatagtattacttaaggaatagattgatagcaagctgctccataggttgcctcaggttacgttttaacttttgacacagaccatccgcagaatgcattttattggtcacgattggagtttagagggatgcaaagttattaacttaccacccgttcgtctggaagtcaaggatgagaaagtaattggcacatgtatccggctgaatatttgtatcacacgtaccaaataaggaaggggattattggcgaaaaggtcaggcaagaccagcagggatttaatgaattttccgttaccaactgagtagggcttcaagatacagggtctcccgctcgagttgtagaattggaacgagagtccggtgccctattttttctcgacttcagttaaagtggggtctatcgctcgtcaaactttgagtgtactagtcaagctcggcgccgatcgttaatgcctgtgggagggttcccttctgggacaaaacggcgttgcacatccaacgtctaattatcgtctgcggtccagtgaagtgcttcccttcgtatgaccggatgcgttgatgaagtccggatgttatgtatgatgcagatcgtgatatgaactcgcgagaagagcaggcgtacgagcagatactgttagggacaagctggtatacatacgaagtcggcgtttattcca
.........

Note:
1. The "background sequences of bio-related promoters" refers to a set of promoter sequences of genes that are not co-expressed or co-regulated. 
   Normally, all the gene promoters of a genome excluding the co-expressed or co-regulated genes' can be taken as the background sequences.
2. The number of background promoters should be at least 30 times over that of co-expressed genes.
3. The name of a gene must be located  between '>' and '|;'.
4. Each sequences  should not be written in multi-lines, but in a single line.
5. The length of the sequences should be uniform.