start:syntheticfg1_orthologous_background
>syntheticfg1_background|;
catagtggggtatctagctaggtctcaagctccgagatgtaaactatgaggcccaaaatcagctaagctgtttggtcaacagccgagggggggcttatcctgggatgaggagggagaagcctgctttgtacctgatttctagaggccgaggcgcgggagcaccgcagtctatcgctctgcaattgggtcttctgccatattgcatcgttccacgctgacgcgtgggggatgaggctcgtgagcaaatttgcttggcctcctgtctctcatcactttcttttaaaagactgccgcacatcttccaacaatcgtcattttttatgtttggccgccggaacgacacagcatacattgcgtgcgctgatgggtagggattaaatgtgtggggcaaccggtggattccaactgagcgggtcgtgagcgatcctatctcatagagcgacttttgaatcaatgcacacagccgctaaggatagcgtcggtgcgaccatagagcgttaccggacacccgtgcttaacaccccatccggcctcgagagttgggacctggaatcgtgtacgatttattggggagcacccgactaggctatcgaacaataaaattagcgaagggtttaatacctggagttaacgccgtatccagacaccacgccctgtgctccagtactagacaagtgagcccgaagccagccctgtggggggggtcagcctggaggttggctcaagagctttatcacttactacgtgtcgtcaaatgtatatctccgaatccgacaacgcgttgtgttagactattccaatacatgtctcggaattcattagccatcgtaggagaattagggatgttagatcggattccgtcggagctccgagcgacagcaacgagaaaagtacatagctttttgggcttgatcccgacacttcggacggcatagggccgatcggaccagtactaatcgcgtagtgtacaaacatcagcgccaacaagattcgtccagataagctcctgtctctttgagatgcgaccggatatcgtcgccgtagccctctgtacaagagggtaagtaagacgagcaaagagactcaagcaagttatggacctgtcctaggcggtcgattaacccagcttctataaccggtcgcaaatttttgaacaaccactgatgataaggagacgagattgcaaatcagttaggctggccaaaagccaccggtatgacggaaaacggtgggggttaatctgatacggatcattcgttccagtaagtcctgacctcagagtctataccaacgcccgcggcttgttcgaccatattgagtagtgtgaggctgccctacgggccacttgtacatgcatgcgaaaccaccttagctgtaccccggaatagccgctgatcagggtcgttaggtagattccctttatcggagtttcaaaccctttttacctcacgttgacatttttttgctagagacctttttggatctattcagctgcccctaacttggacgatacatatcggatatacggctgaaaagtttc
>syntheticfg1_1_background|;
catAgtgCggtatctCgctaggtcGcAagCtGcgagatgtaaactatgCGgccAaaaatcagctaagctgtttGAAcaaAagCcgaGgggggActtatcctgggatgaCGGgggagaAgTctgctAGgtaccGgaCtGcAagaggCcgaggcgTgAgTgTacAgcagtctatGActctgcaattgggtTCtGtCccataGTgAatcgttccacgcTgacgcgtgggGgAtgCggAtcgtgagcaaatttCcttggccAcctgtctctcCtcacCTtGttGtaaaagactgccgcacaGAGGccaacaatcgtcattGttTAtgtttggccgccAgaCcgacaGagcataCatGgcgtgcgctgatgggtagCgattaaAtgtCtgggTcGaccggtCgattccaAcTgagTgggtcTtgagcgatcctatGTcTtTgagcgacttttgATtcaatgcacacagccgcGTaggatagcgtcggtgGgaccataTagcgttacTTgacacccgCgctCaacacTccatccggcctcTagagttgAgacCtggaatcgtGtacTGttATtGTgggagcacccgaCtaggcGaACgaacaataaaattagcgAagggtttaAtacAtTgagttGacTccgtGtcCagacaccacgTcctTtgctcAagtAcAagGcGagGgagcccgaaCAcTAccctgtgggTgggGGcAgcctggaggttGgctcaaTaCctttCtcacttactGcgtgtTgtcaaatgCataCctGGgaTtccgCcaCcgcTttCtgttTgaCtaGtccaATacatgtAtCggGattcattagAcatAgtagTGgaattaCggatgtTagatGAgattccgGcggagcGcAgaGTgacaAcaacgaGaaaTgtacatCCcGGttCgggctCCaAcCcgacacttcggAcggcataCCgccgatcggaccagGactaatcgCgtaTtgtacaaacatcagcgccaTcaCgattcgtccagatCagcCcctgTctcttAgagatgCAaccggaTatcGtcgccgtagccctctgtacaagCgggtaGgtaaGacgaACaGaTagactcaagcaagTTaTggCCCtgtcctaGgcggtcgaTAaCcccagcttcGaTaaccggtTgcaAatttttgaaTaaccactgatgataaAgTAaGgagattgGaaatcagttaggctgAccaaTagccAAAggtAtgCcggGaaacggAgggggttaatctgaTacggGtCattcGAtccagtaGgTAcCgacctcagagtctataccaAcgTcGgcgGctACttcgaTcataAtCaTtagtgtgaggctgcAcGacCgAccacttgtacatgcatgcgTaTAcaCAttagTtgCaccTAggaatagcTgctgTtCagAgtcgttagGGaAattAcGTtGatcggagtttcaAaGActCtttacctcacgttgacatttttGtgctagGgaccttTttggGtctaAtcagctgccTctaacCtggAcgatacTtatTggCGaAaTTgctgaAaTgtttcA
>syntheticfg1_2_background|;
cataGtggggtatctagcTaggtctcaGgcCcGgaGaGgtCaacCatgaggCccCaaatCagctaagctgtttggtcCTcagAcgCggggAggcttaAcctgggAtgaggaAGgaCaagGGtgctttgtacTtgatttctagTggccgaggcgTgggagAaccgcAgtctAtcgTtctCGaaGtgggTctGctgccCtaTtgcatcgttccTcgctgacgcgGggGggatgagGctcgtgagcaaattACcttggcctccGgtctcTcaGcacttGcttttaaaagCctgccGcacatcCtccTGcaatcTTcatGttttTtgCttggccgccgCaacTacaAagcaCTAattgcgtgcTctgatgggTagggattGaatgAgtggGgcaCCcggtggattccaactTaTcggTtcgtgagcgaGTctatcAcataCTAcgacttttgAAtcaAtAcaTacagcCGctTaggatagcgtcggTAGgaccatagCAcgttaAcggacacccgtgcttaacaccccatccggcAtcgagagttgGgacctggaaTcgtgTGcgTttACtAggggagcacccGaCtaggctatcgaacaaGaaaAttaAcCaaGggtttCCACcctggAgttaCcgGcgtatccagaGaccAcgccctCtgAtcTagTactagacaGgtgaGcccgaagAcCgcccTgtggggggggGGaGcTtggaggtTggctcaagagctttaTATcttaGtTTgtgtcgtcaaatCtaCatctGcgaatcGgacaAAGcgttAtgtTagactatAccCatacAtgtctcgGaattcattagCGatcTtagAagaattagggatgtTaCaAcggatGccgtcggagcAccTaGcgacagcaacTagaaCCgtacatagcttAttgggGtTgaGccGgacacCTcggTcggcaATTGCcAgatcggaccagtaCGaatcgcTtAgtgGacCaacatcagcgccaAcaAgatAcATccagataagCTActgtctcAttgagGtgcgAccgGatatAgTTgccgtaTCcctctgTaACagagTgtaagTaagGGgagcaaagagaTtcaagcaTgAtatggacTtgtActaggcggtAgCttaAACcaTctCctataTcCgAtcgcaCTTttttgTacaCccactgTtgataTggagaTgaCAttgcaaaTcagtTagCTtggAcaaTagccaccCgtaAgacggaaaacgTtggggTttaatAtAataTggatcattcgttccaAtCagGGctgacctcagagtctataGGaacgcccgcggcttTACcGaCcaAatCgagtAgAgtgCGgCtgCcTtAcgggccacttgtacatgcatgcTaaaccaccttTgGtgtacTcCggCAtagcTGctAatcTggTTcgttaggtGCattccctttatcggagtttcaaaccctttttacctcacgttgaTatttttttActagGgaccCGtAtggatctattcagctTccTctaaAttggTcgatGcGtatcGgatatacggAtgaaaGgtttct
end_orthologous_background
start:syntheticfg2_orthologous_background
>syntheticfg2_background|;
tatcggaactgcttcttcttttgtacagcattccgaccacaccagaccgttatagaatcgggcacgttctgaaatctggcttacaatgtgacgcgctaaacctcgctatcttaccacttccgcacgctctttgatgctcggtcacctagatcgtatgccaataattcgatttcttcctatcaattgactcagcggggcgtggggtcttttacgcccgatgacaaaccggttcaagcggccttggcccgcgctcgtccgctcgcgtcaagatatcatagcaagatgatgttcgcttcggcctgagaacccacttggcgtaagtaggggatacggttccgattcttttggacaagggatcctgcatcactgagtcacgcgaagtctgtaaggcggcggaaaattaaacaattactggctccctgagtacgcagaaatgcaatatgtacaccgatctgaaggcatcaggcgtgtataccctcgacgattcggtagccaactcctgcaatgaggagagcagccactggtaatcccccgcacgttattcggatcaaaagggcagggtataggatacacgggactcgaacacttcaagtctagattcttaaaccaataatataaatcctctcttggcagatgtaaagagtccctggccgatatcaaactctggattaaatcgtacgtatttaaccggagatctgttgcgagtttaggcgtgggtgaggcccgttgtatccagtcgagcctaggttgtatccatatgctctagaggccgcctaaatcggatgcaccgtaccagtaaaaacggcgccgcaagcgacttcccgaattttcatgcgcaccacaggttaactgcgccgcagagagagccagatatgccccggcagtgcgcggaactccaaaacgggatctatcctccatatgccccccgcggcgccttatttcgttgagaaacaaagaaaggtaggaggctttaacttggcacaatcatgcctccggaattcccttgcaggtaacagtgcgtggaggaatggatcgccccttctagagcttcgagatttgctctatgcacaagccaaaaggacagcgtctcgcatatagctcatagcatcattttgcaatgtcacctctcggcctaggttacccgttcccggtagtctctgtggcctggtggaggaacttcgaccccgcgtacgcttgaaaagataaggggctagcaagtggggaaaaaatatcggcgtaggttgagccctggaccatgaatcatcggccaagtctcagactgaaaattaaagaatcatctgttgccaggcctgtgttgcacaccaaggcagtgttagcatgaaacattgctacagggatgattccctcggggccggccatctgattacgaacacgcattgaagtgactcatcgtgaactataccttcccaacccatcgccctctgcacgtgtaaattctcgcaggctaatgtgaggttgtctagaactccatggttcgtgcgtgagagccggctctgtgtggcttgcaacgagacgggtgg
>syntheticfg2_1_background|;
taAcggTactgcttcttcttttgtacagcattcCgaccacaccagTcAgttataCaatcCgTcacgttctgaTGtcTgTcttacaatgTgacCcgAtaTaTcGcCctatcttaccacttCcgcacgctGttAgaCgctcggtcacctagatcgtatgccaGtaattcAaGttAAtcTtatcTattgactcagcggggAgtggggtcttttTcgccGTatGacaaaccggttcaagcTgGcttggcccgcgctTgtccgcCcgcgtcaagatatCatagcCagTtgTAgttcgATtTggcctgagaaTccacttggcgtaagtTggggataCggttccgaAtcttttggacaAgggatTCtgcatcacAgCgACacgcgaagtGtgAaaggcggcCgaCGattAaTcaattactGgctccctTagtCcgcagaaatgcATtatgtacaGcgatctgaaggcatcaggAgGgtCtacGGtcgacgattCggtaCccCactcctgcaatgagTGgagCagTcaGtggtaatcccTcgcacgttaGAGggatcaaAagCgcTgggtCGaggataGacgggacAcAaAcaTttcaaGtctagTttctTaaacTAataaGatAaatcctctCttggcTgatgCaaaAGgtccctAgAAgataCcaaactctggattaaCtcTtacgGAttAaaGcgTagatctgttgcgagtttCgCcgtgggCgaggcTcgttgCatccagtcgGgcctaggttgAatcCatatGctcCagaGgcTCcctaaatcggaTgGaccgGaccTTtaaaaaTgCcgccgCaaCcgaGttAcTTaaCCttcatgcgcGccacAggttaactgcgccgcagaAagagccTgatTtGccccggcagAgcgcggaactccaaAacgggACctatCctCcCGatAGcccTTgTggcgccttTtGtcgttgagaaacaaagaaaggCaggaggctttTacttTTcGcaatcatgccCccgAaAttcccttgcagGtaacagCAcTtgCaggaGtggatcAcCccCtctagTgCTtcgGgGtttgcAcAGtTcacTaCccaaaagAaCCgcgtctcCcCGatagcTcaAagcatCattCtgcaatgtCacctctcCgTctagAttacccgAtcccggtagtctcGgtACcctgAtCgaggaTcttcGaTcccgcgtacgcttgaaaAgataaggggcTagcaAGtgggTaTaaCatGtcTgcgtagGtAgagcccTggaccatgaGtcatcggccaagtctcagactgGaAGttaaagaatcatctgttgGcaggTctgtGtCgcacaccTaggGagtgAtagcatgCaacTttgctAcaAggatgatCGAcCcggAGAcggccaTAtgattacgaaCacgcattgCaAtgaGtTACcgtgaactGtaCCTtcccaacccAtTgccctctgcacgtgtaaAGtcAGgcaggctaGtgtTaggttGtctaCaaCtccatGgttcgtgcgCgagagccggctcAgtgtggcttGcaAcGagacGgTtg
>syntheticfg2_2_background|;
CatcggaactgcttctGcttttgtGcagcTGtAcgaccacaccaGaccgttatagaatcgggcGcgttctTaAatctggcTtTCTatAtgacgcgGtaaacctcGctatGttaccTcttccgcacgTtctttgatgctGggtcacctagaTcgtatgTAaatGaAtAgatttcGGAGtatcAAttgactcCgcgggGcgCggggtcttttCcgcccgatgacaAaGcggttcaagcggcAttAgcccgCgctcgTccgctcgcgtcaaTatGtcaCaGcaagatgatgttCgcttcggcctgagaacCcacttggcgtaagtagGggatacggGtccGattctAttgACcaCgAgatGctgcatcaTtgagtcacgcgaGgtCtTtGaTgcggcgTTaaAttaaacaatCactgGctcCctTagtacgcagATatgcaatTtgGaAaccgatctgaaTgcaAcaggcgtgtataccGtcgacGatACgGtagccaGctccTgcCatgGTAagaAcagccactgTtaatccccTgcacgttattcgTatcaaaaggAcaggGCataTgataGaCgggactAgaAAactCcaTgCctCGattcttaaaccGataataCaTaCcctctcttggcagatTtaaagAgtccctggccgatatCaaactcCggaTtaaaGcgtacTACtttaaccggagaCcTgttGcgagtttaggcgtgggtgaGgAcTgttgtatTcaCtcgagcctAggttgTatccTGatgCtctagaggcCgcTtaaaTcggTtgcaTcAtaccagtAaaaacggcgAcgcaagcgacttAccgaatttGcaTGcgTaccacagCTTaactgAgccgcagagaCagGcagatAtgccccgGCaCtACCcggaactccaaaacgggatctatccTccatatgTccCccgcggcgcctCaAttcgttgagaaacaaaGTTaTCtCggTgTTttAaacttggCacaatcatgccGAcgGaatGcccttAcaggtaacaTtgAgtggagAaatggatAgccccttctagagCCAcgagaAtCActcAatgcacaagccaaCaggGcagcgtctcgcatatagcGcataCcatCatGttgcaaGgtcacctctcggccGagCtAacccAttcccgCtCgtctTtgtggcctGgtggaCgaTcttGCaTcccgcgtacgctGgaaTCgataaTgggctGgGaagtggAgaaaCaatTtcgTcgtaggttgagccctggAccatgCAtcatAggcTaaCtctTaCGctgaaaattaaagaaGcatctgtGgccagGcctgtgtAgcacaccaaggcagGgTGaGcatgCaaCCGGActacGgggatgaCtAcCtcgggTcAggTcatctgattacgaAGacgcCttgaagtACctcaAcgtTTaCtataccttcccaacccatcgccctcTgcaCgtgtaaattctGgcagActaaAgtgaggtGGtctagaaAtccatggttcAtAcgtgagagGcggGActGtgtggcttgcaacgaAacgggtg
end_orthologous_background
......

Note:
1. In this window, you should paste the background sequences that are not phylogenetically related for each of the orthologous promoter groups.
   It is suggested that the background sequences are generated by randomly picking promoters from the genome.
2. The length of background promoters should be at least 30 times over that of orthologous sequences.
3. The format of background sequences is as follows:
   start:[gene name]_orthologous_background
   >ortholog1_background|;
   sequence 
   >ortholog2_background|;
   sequence 
   ........ 
   end_orthologous_background
4. The gene names must be:
   1)located between the symbols '>'and '|;';
   2)uniform among the three sets of input data, including 'bio-related dataset', 'orthologous promoters of bio-related genes', and 'background sequences of orthologsous promoters'.
5. Each sequence should not be written in multi-lines, but in a single line.